Guest viewing limit reached
  • You have reached the maximum number of guest views allowed
  • Please register below to remove this limitation

Forskolin transdermal for fat burning, tanning, and acne fighting.

warriorway

Member
I'm going to whip up a transdermal forskolin. I am also thinking of adding some yohimbine, I've read that oral vs. trans is equally effective but I can make tons of transdermals and it's easier than capping. I also want to add some kind of antioxidant to the mix, perhaps cat's claw.

Anyone else have any suggestions?

Here are links to a couple articles:

Invalid Link Removed
Coleus oil was found to more effectively inhibit the growth of skin pathogens including Propionibacterium acnes (associated with acne) 7 , Staphylococcus aureus (a bacterial strain found in infected wounds and skin eruptions including acne) 8 , Staphylococcus epidermis a bacterial strain occurring in a variety of opportunistic bacterial skin infections and in acne.


Invalid Link Removed
Another potential way to increase the amount of melanin in the skin is gaining some publicity from a Sep. 21 article in Nature. Whereas melanotan (Clinuvel, epitan) uses a synthetic melanocyte stimulating hormone, forskolin stimulates the production of melanocyte in fair skinned individuals by raising a chemical known as cyclic AMP (cAMP)
 
Does anybody have any of the stronger extracts of forskolin? Anywhere from 40-95%. I would be interested in trading for some of my homebrew TDS(transdermal delivery system).

Otherwise the 20% forskolin we can get from board sponsors will be fine. I have read that forskolin may work synergistically with all the other compounds in coleus forskolli.
 
Well I am pretty interested to see your results here, I hope you find a stronger extract. The only thing I have seen that was extremely pure was USP's bolic, but that was a limited run supp.
 
CustomNW told me he was working on getting the 95% stuff again. Of course for the acne fighting it's actually the essential oils in the herb and not the forskolin that is credited. But yeah, if I had 40-50% forskolin then that would be better.
 
Sounds very interesting. Keep us updated.
I'm interested in your results.

I just have no idea what carrier you'd put this stuff in. Might want to ask the Avant folks.
 
Forskolin is soluble in dmso and ethanol, I hope Isopropyl alcohol will work because ethanol does irritate the skin.

I have all the supplies to make a hydro alcoholic carrier, kind of like t-gel. I'll just have to play around with the formula and I think it will work.
 
DMSO is a no-no for me. I used it when I ran 1-test/4-ad a few years ago - really irritated my skin for a long time.

Skulpt I can tolerate for 4 days per week - then I have to use something else.
 
i've been pondering trying this too, was waiting till I could find over 90% forslean without having to buy a kilo from sabinsa :)
 
Yeah I don't want to use dmso either, hopeful isopropyl alcohol will work. I've seen msm used in transdermals before, I don't know how harsh that would be on skin though.

Methylsulfonylmethane (MSM) -- also known as methyl sulfone or dimethylsulfone (DMSO2) -- is an odorless breakdown product of dimethyl sulfoxide (DMSO)
 
I found 2 similar products on the net where yohimbine was the main ingredient. One was Patrick Arnolds, it was Water, isopropyl alcohol, dmso based. The other one I found only had water and carbomer.

I will use forskolin and greet tea extract in a 2:1 ratio. I am using green tea for the antioxidant EGCG, and a little caffeine kick.

For my TDS I will try something that should be easy on the skin. I guess the formula depends on how well the alcohol and terpenes can dissolve the forskolin. I don't want to use too much alcohol so I'm going to try starting at 20%

Water 50%
isopropyl alcohol 20%
emulsifying wax 10%
extra virgin coconut oil 5% (for lauric acid and skin penetrating enhancer)
extra virgin olive oil 5% (for oleic acid, spe and vit E)
sweet almond oil 5% (for vit B1,B2,B3, B6 and B9)
d-limonene 2.5% (for a natural terpene, vit c and spe)
eucalyptus oil 2.5% (for a natural terpene, antibacterial, and spe)

edit
That formula didn't work and the eucalyptus stinks.
 
Subbed, cause I've got that wonderfully burnable Irish skin.
 
My second batch I am more happy with, but not quite 100% It seemed to work well but it's dark brown. Maybe I should back off on the ammount of forskolin I put in it. In 4 oz of carrier I put in 7 grams forskolin and 3.5g green tea. I rubbed 1/2ml on the back side of my L forearm. It seemed to darken the skin for 5 minutes or so but now there's no significant difference between my other arm.

It has a nice sweet eastern spice smell, there is absolutely no citrus scent from the limonene. In the 1t 4 ad trans I'm using the lemon scent just kills me.
There is no oily residue left on the skin, maybe I can increase the ammount of oil in it and the d-limonene.
It is a little thin for my liking, I like a thicker smoother product.

The formula I used was closer to my tried and true recipe, I didn't want to play around. My first batch with all the water didn't hold too well, I think it seperated from the water and clumped together.


I think for my next experiment I will cut out the water and see what happens.
 
I have a pretty good formula I think anyone could make. If not for the isopropyl alcohol everything in it is natural. The stuff goes on good, it's thin but doesn't run all over the place. It dries fast, doesn't feel greasy and makes you look tan!

I got it pretty potent for my sample 2oz batch. I put in 5 grams forskolin and 2.5 grams green tea extract. That equates to 125mg per ml.

Here's the ratio's

isopropyl alcohol 40%
emulsifying wax 10%
extra virgin coconut oil 20% (for lauric acid and skin penetrating enhancer)
extra virgin olive oil 10% (for oleic acid, spe and vit E)
sweet almond oil 10% (for vit B1,B2,B3, B6 and B9)
d-limonene 10% (for a natural terpene, vit c and spe)

1st step
In a glass jar measure out the alcohol and d-limonene. Then add the forskolin and green tea. Warm it in the microwave for 20 sec, shake until blended.

2nd step
In a seperate glass jar measure out the oil's and emulsifying wax. Warm it in the microwave in 30 second increments until fully melted.

3rd step
Re warm the forskolin for 10 sec in the microwave and slowly stir in the oil mix. Stir for 1 minute to get a good emulsion.

The next part I found works best for getting it thicker, otherwise if I just bottle it, it stays very runny. I put the jar in the freezer uncovered for 10-15 minutes until it turns into a thick paste. Then I take it out and let it warm up some it will become thinner. Use a funnel and pour it into your lotion bottle. Voila your done!

Emulsifying wax is very cheap I got mine from snowdriftfarm.com The d-limonene I got at greenterpene. com
Everything else you can get at the grocery store and from board sponsors.

Edit-
The freezer trick didn't work too well at these ratio's. It did work on my previous batch when I had half the alcohol and much less forkolin. The color was also a medium brown instead of dark brown. It felt too greasy though, like I just got a massage from this chick who likes to use alot of lube.
 
I figured how to get it in a lotion base. I have this lotion base and polymer sp thickener. But whenever I tried adding alcohol in it it would just crash. Now I figured out the trick.
I mix the lotion base with water and add the thickener and mix until I have a thick lotion. Then I mix my forskolin, green tea, limonene, and alcohol together until it's dissolved. Add the oils to that mix, then add it to the lotion base a little at a time and mix until it's fully mixed. It never crashed that way.
I have one batch where I just tried a few grams forskolin and that turned out to look like creamy peanut butter.
I did another batch that had 125 mg per ml, that stuff is dark brown and a little thinner than the peanut butter.

I like this formula better because it's 50% water so it wont be as intense on the skin.

I've been using forskolin for about a week and last night the scale said I was down 5 pounds from before. I don't know how well the scale will measure my progress because I've been on some 1test, 4ad transdermal too.
Today I measured my bf, I got a few measurements saying 8-9% and a few saying 10-11% so I guess I would say I'm in the 9-10% range My waste at the navel was 34"
I do look tanner but still have some bacne.
 
I am interested to see how this works out because I get a lot of gastric distress from forskolin, but would like to use it for the recomp effects. Plus I could use a tan!

What do you think about adding it to a pre-made transdermal carrier like Penetrate?
 
is 350 per ml too potent? let me know

Yes, I think 30-60mg per ml would be ideal, unless you can get a more pure extract. The stuff from np is dark.

weakestlink said:
Hey I would like to learn how to make a trans dermal I have the same idea something home brewed for my back acne. Think you could help me out a bit?

Yeah I've seen tons of stuff that would work for that when I was researching for things to put in a formula. The easiest idea I have which I haven't tried but think it would work would be to take 4 oz of lotion, pick up some forskolin and some vit b-5 in bulk powder. Try mixing a gram or 2 each with an ounce of isopropyl alcohol in a glass jar, warm it up in the microwave for 30 sec then shake it up to get it mixed. Dump out the lotion in a seperate glass jar and slowly mix in the alcohol solution a little at a time until it fully mixes in. It should hold at that ratio but if it crashes and turns into a liquid you can always bring it back by slowly mixing it into another ounce or two of lotion.
 
Thanks!

Any new results to report since your last post?

No real news but I have noticed a bit less acne. It kind of irritates my stomach area so I try not to put it there too much.

One problem I encountered with my formulas was that I had way more rub off at 125mg per ml when it was in a water based carrier then when I was using just oils and alcohol. So I had to cut the ammount of forskolin down by half and then they both seemed to work about the same.

I've mainly been using forskolin to enhance my 1t 4ad transdermal as a source of cellular energy. Here is why I'm using it.
(D) Source of Cellular Activation Energy
The process by which transdermal drug delivery operates involves moving molecules across chemical and electrical gradients. Under ordinary tonic conditions, the introduction of materials through the skin results in chemical cascades that consume relatively large amounts of energy as the body seeks to defend itself against the challenge. Therefore, the topical transdermal delivery system of the present invention, according to one preferred embodiment, includes a substance which brings stored energy or the stimulus for release of stored energy on a cellular level, thereby minimizing energy- negative reactions, which could lead to sensitization, ACD or anaphylaxis. By including such stored energy substance, there is a multiplied net increase in available cellular energy and, accordingly, the potential acceleration of those reactions which result in the active agent ultimately reaching its target and being effectively utilized by the body.
While the composition may be formulated to utilize adenosine diphosphate (ADP) or nicotinamide adenine dinucleotide (reduced form) (NADH) or flavin adenine dinucleotide (reduced form) (FADH 2 ) such compounds tend to be unstable and, therefore, are often not preferred.
There has been identified a group of botanical compounds which, due, apparently, to so-called signaling mechanisms, induce high concentrations of enzyme-substrate complexes to be formed, such as by activation of the N S (stimulatroy) protein of adenylate cyclase, thereby resulting in cellular levels of adenosine 3′,5′-cyclic monophosphate (cAMP) approaching the maximal limits of cellular cAMP concentration.
In particular, extracts of the plant Coleus Forskholi, and especially, Forskolin, a labdane diterpenoid, have been found to have a particular ability to stimulate the production of cAMP in cells (Refs. 14 and 15). Other extracts of Coleus Forskohli, such as, Colforsin or coleonol, for example, may also be used.
Other examples of activation energy sources for stimulating generation of cAMP, either via precursors or cellular activators, include, for example, methyl anthines, Saikogenin and Saikosaponin, Angelacie dahuricae radix (yielding angelic acid), phelopterin, oxypeucedanin.
Examples of substances which stimulate cellular production of cGMP include acetylcholine, cytidene diphosphocholine and ascorbic acid (Vitamin C).
The amount of the activation energy source will depend on such factors as, for example, the mechanism of action of the active agent, energy of activation (positive or negative) when active agent encounters its intended receptor (to enhance or decrease cAMP or cGMP levels), etc. Generally, suitable amounts of forskolin or acetylcholine or other source of cellular activation energy, will fall within the range of from about 0.001 to about 0. 1%, preferably, from about 0.001 to about 0.01%, more preferably, from about 0.001 to about 0.005%, based on total composition. As will be appreciated by those skilled in the art, cGMP is considered an antagonist for cAMP. cGMP stimulation will generally be appropriate for situations where it is desired to enhance immune function, such as lymphocyte mediated cytotoxicity, during infection, carcinogenesis, etc. Conversely, cAMP stimulation is generally appropriate in situations where immune system modulation is desired.
 
I was originally planning that but after reading the sticky on it the consesus was it wasn't worth it.

I did find out today that at 60mg per ml forskolin using the emulsifying wax in the formula eliminated almost all the rub off. That was something that was bothering me, and now I think it's working really well. I'm happy.
 
Sure, It's not quite the final formula I had to tweak it at the end because it crashed(too many liquids) and instead of making more gel to bring it back I just threw in some wax, it worked the best to date. It's flawed because I overflowed my 10 oz bottle. It yeilds 10.4 oz

If you find my thread "Thinking of making my own transdermal carrier" at the end of the thread I have explained the different phases of how I mix it together. I think the best way to do it would be to mix the emulsion with the solvent then add the solvent to the gel.

Gel phase
water 5oz
polymer sp thickner(sodium polyacrylate) .4oz

Solvent phase
91% isopropyl alcohol 2oz
dmge .8oz
propylene glycol .8oz
d-limonene .8oz
Forskolin 10g
green tea 5g

emulsion phase
emulsifying wax .8oz
extra virgin organic cocounut oil .2oz
extra virgin olive oil .2oz
sweet almond oil .2oz
 
One quick update. I've been using about 64mg forskolin ed with my 1t-4ad transdermal and I do have some noticeable tan lines before applying. I have not been in the sun tanning my back and chest at all.

It seemed like it was working ok with acne but I did break out with 3-4 zits in my upper middle back in the area where it's really hard to reach to scrub with soap and to apply my transdermal.

For fat loss I haven't really been dieting and I've been eating spaghetti the last couple nights so I'm feeling a little carb loaded.

I whipped up a nice girl friendly batch and gave one to my mom. Except for the minimal ammount of isopropyl alcohol everything in it is all natural and she straight up loved it. It's actually a really good lotion it makes your hands silky smooth. I kept the dose of forskolin and green tea pretty low about 8.3mg per ml each and it's a nice light tan sort of peanut butter color. I also fragranced it with some amazing grace which I knew she likes. There's zero rub off at that dose which is good.

I also saw something about a water soluble colforsin, I might try to find more about it, I think it would work way better.
 
This could be a dumb question, but has anyone tried using the formula used in the rat study?

Chemicals
Unless otherwise indicated, a crude extract of Coleus forskohlii root preparation was used as a working source of forskolin (ATZ Natural, Edgewater, NJ)18. Purified forskolin was purchased from Sigma-Aldrich Chemical Corporation (St. Louis, MO). All topical agents were prepared as a weight:volume solution in a standard dermatologic vehicle of 70% ethanol, 30% propylene glycol (Sigma-Aldrich Chemical Corporation, St. Louis, MO). The C. forskohlii extract-derived topical preparation was made by mixing the dry root powder (extract) with vehicle for 1h at room temperature on a stir plate with constant agitation. Next, the solution was centrifuged (10 min, room temperature, 2,000 x g) and the soluble portion (supernatant) was collected and filtered (0.45 µ cellulose acetate filter). The C. forskohlii extract was stored at room temperature. Assay of content by the manufacturer (as well as independent analysis) confirmed that forskolin accounted for 20% (w/w) of the root extract in powder form.

Although I doubt anyone actually has access to a centrifuge.

Joe
 
Where was that from? It seems like a centrifuge is how they can find out how much forskolin was in the coleus.

No I never tried that formula ethanol dries out the skin. I was looking at 99% foskolin from a chem company and it said their research showed ethanol lowered the effectiveness of the forskolin and they reccomended 5%dmso to make the forskolin soluble.
 
Thanks but I have a hard time reading that second link it won't do anything in a web browser, and the file it downloaded is written in html.
 
It's a word file Here it is copied.

Joe

Supplementary Information
Materials and Methods
Animals
C57BL/6JJ mice of varying pigment phenotype were crossed with K14-SCF transgenic animals also on the C57BL/6JJ background15. The pigmentation phenotypes used were C57BL/6JJ MC1RE/E Tyr+/+ (wild type, black pigmentation), C57BL/6JJ- mc1re/e (extension mutant, blonde pigmentation, abbreviated mc1re/e; Robbins, L.S., et. al., Cell, 1993, 72 (6): 827-34), and C57BL/6JJ MC1RE/E Tyrc-2J/J (albino, non-pigmented, abbreviated Tyrc-2J; Le Fur, N. et. al., Genomics, 1996, 37 (2): 245-8) animals each purchased from the Jackson Laboratory (Bar Harbor, ME). Presence of the K14-SCF transgene was assessed either by phenotype (in the case of wild type or extension animals because of obvious skin color characteristics) or by pcr amplification of DNA obtained by tail snip of a fragment specific to the K14-SCF transgene as described15 in albino animals. Xeroderma pigmentosum group C knockout mice originally generated in 129-derived embryonic stem cells but back-crossed onto the C57BL/6 background21 were purchased from Taconic (Germantown, NY). Transgenic dopachrome tautomerase-β-galactosidase mice (Mackenzie, M.A. et. al., Dev Biol, 1997, 192(1): 99-107) were obtained from Dr. Ian Jackson’s laboratory. All experiments were carried out in accordance with institutionally-approved animal protocols.

Cell Lines
The Pam212 mouse keratinocyte cell line was graciously provided by Dr. Paolo Dotto (Massachusetts General Hospital and Harvard Medical School, Boston, MA) and the Melan-C mouse melanocyte cell line was generously provided by Dr. Dorothy Bennett (St. George's Hospital Medical School, London, U.K). Pam212 cells were grown in DMEM media supplemented with 10% fetal bovine serum, penicillin, streptomycin and L-glutamine, and Melan-C cells were grown in Ham’s F10 media supplemented with 10% fetal bovine serum, penicillin, streptomycin and l-glutamine. Cells were grown to 40-60% confluence prior to use in irradiation experiments in humidified incubators supplemented with 5% CO2.

Chemicals
Unless otherwise indicated, a crude extract of Coleus forskohlii root preparation was used as a working source of forskolin (ATZ Natural, Edgewater, NJ)18. Purified forskolin was purchased from Sigma-Aldrich Chemical Corporation (St. Louis, MO). All topical agents were prepared as a weight:volume solution in a standard dermatologic vehicle of 70% ethanol, 30% propylene glycol (Sigma-Aldrich Chemical Corporation, St. Louis, MO). The C. forskohlii extract-derived topical preparation was made by mixing the dry root powder (extract) with vehicle for 1h at room temperature on a stir plate with constant agitation. Next, the solution was centrifuged (10 min, room temperature, 2,000 x g) and the soluble portion (supernatant) was collected and filtered (0.45 µ cellulose acetate filter). The C. forskohlii extract was stored at room temperature. Assay of content by the manufacturer (as well as independent analysis) confirmed that forskolin accounted for 20% (w/w) of the root extract in powder form.

Sunless tanning experiments
C57BL/6J animals between 5 and 10 weeks of age were used for these experiments unless otherwise noted. Dorsal hairs were trimmed using animal shears with a 0.25 mm head (Fisher, Pittsburgh, PA). Preparations of forskolin were applied to the sheared skin as described. Solvent (vehicle) control consisted of the same volume of ethanol/propylene glycol (without forskolin) applied to the skin of age-matched genotype-matched cohorts. Unless otherwise indicated, animals were treated once daily on their dorsal surface with 300 – 400 µl of topical agent for 5 days a week. Skin reflective colorimetry measurements were assessed with a CR-400 Colorimeter (Minolta Corporation, Japan). In all cases, the instrument was calibrated against the white standard background provided by the manufacturer before use. Degree of melanization (darkness) is described as the colorimetric measurement on the *L axis (white-black axis) of the Centre Internationale d’Eclairage (CIE) L*a*b* color system29.

UV exposure
Animals were briefly anesthetized with inhaled isoflurane, hairs were sheared with an electric animal clippers outfitted with a surgical preparatory clipper head (to cut hairs to 0.25 mm). Next, animals were exposed to ultraviolet irradiation in a custom-made Lucite chamber (Plastic Design Corporation, Massachusetts) designed to allow freedom of movement while being irradiated. UV was delivered by a double bank of UVB lamps (UV Products, Upland, CA, peak emission at 302 nm) and UV emittance was measured with the use of a UV photometer (UV Products, Upland, CA) equipped with UVB measuring head. The delivered doses were calibrated for UVB emittance. Photometric measurements revealed an additional ~25% dose of UVA emittance from the radiation source. Skin samples were biopsied at indicated time points after UV exposure. In the case of in vitro UV experiments, cells were exposed to 10 mJ/cm2 UVB radiation in a Stratalinker UV chamber (Stratagene, Cedar Creek, TX) equipped with 15W 254 nM UVB bulbs (Stratagene, Cedar Creek, TX) and calibrated using a UV photometer (UV Products, Upland, CA) equipped with UVB measuring head. For all of our experiments, we calibrated UVB dose from the lamps using a UVB-specific photometer and expressed the dose relative to the directly measured UVB exposure.

RNA extraction and Quantitative Polymerase Chain Reaction
After exposure to UVB radiation as described above, melanocyte or keratinocyte cells (as indicated) were incubated at 37ºC in humidified incubators supplemented with 5% CO2. After 24 hours, media was removed and collected. This conditioned medium was used directly or depleted of MSH by serial incubation with anti-alpha-MSH (30 µg/ml, Sigma, 24h, 4°C) followed by anti-rabbit lgG (United States Biological, 10 µg/ml, 1h, room temperature) and protein A/G beads (50% (v/v), Pierce Biotechnology, 2h, room temperature). Conditioned media was added to mouse B16 melanoma cells for 6 hours. Cells were washed once with PBS, pH 7.4, and RNA was extracted using the RNAEasy method (Qiagen, Valencia, CA). RNA quantification and purity were assessed with UV spectrometry (optical density at 260nm/280nm). mRNA expression was quantified by quantitative Taqman pcr using QuantiTect Probe RT-PCR kits (Qiagen, Valencia, CA) and on an iCycler machine (BioRad, Hercules, CA). Murine POMC mRNA expression utilized the following reagents: forward primer: AGCAACCCGCCCAAGG, reverse primer: GCGTCTGGCTCTTCTCGG, probe: [6-FAM]-CAAGCGTTACGGTGGCTTCATGACC-[TAMRA-6-FAM]. Murine GAPDH mRNA expression relied on the following reagents: forward primer: GGCAAATTCAACGGCACAGT, reverse primer: AGATGGTGATGGGCTTCCC, probe: [6-FAM]-AGGCCGAGAATGGGAAGCTTGTCATC-[TAMRA-6-FAM]. Human POMC mRNA expression relied on the following reagents: Human GAPDH expression relied on the following reagents: Human Mitf reverse 5’- CGAGCTCATGGACTTTCCCTTA-3’, Human Mitf forward: CTTGATGATCCGATTCACCAAA, Human Mitf probe 6FAM-CCATCCACGGGTCTCTGCTCTCCAG-TAMRA6FAM, Mouse Mitf forward GGAGCAGAGCAGGGCAGA, Mouse Mitf reverse CATGCACGACGCTCGAGA, Mouse Mitf Probe: [6-FAM]-AGTGAGTGCCCAGGTATGAACACGCA-[TAMRA-6-FAM], Human GAPDH forward GAAGGTGAAGGTCGGAGT, Human GAPDH reverse GAAGATGGTGATGGGATTTC, Human GAPDH probe : [6-FAM]-CAAGCTTCCCGTTCTCAGCC-[TAMRA-6-FAM], Mouse GAPDH forward GTGGATCTGACGTGCCGC, Mouse GAPDH reverse TGCCTGCTTCACCACCTTC, Mouse GAPDH probe: [6-FAM] GGAGAAACCTGCCAAAGTATGATGACATCA-[TAMRA-6-FAM], Human POMC forward: CTTGCAGGCCCGGATG, Human POMC reverse: AGCAGCCAGTGTCAGGACCT, Human POMC Probe: [6-FAM]-ACCACGGAAAGCAACCTGCTGGAG-[TAMRA-6-FAM].

Mitf Quantification
Pam212 mouse keratinocytes or primary human keratinocytes were irradiated with 10 mJ/cm2 and incubated for 24h (37°C, 5% CO2). Supernatants were collected at 24h and these keratinocyte-conditioned media were used to replace the media of either B16 mouse melanoma cells or primary human melanocytes (respectively) growing in log-phase. After 6 hours, cells were harvested for protein or RNA analysis. For protein isolation, cells were lysed in Tris hydrochloride (ph 8.0) 50 mM, NaCl 150mM, EDTA 5mM, Sodium deoxycholate 0.5%. SDS-PAGE analysis and western blotting were performed by conventional techniques using the C5 monoclonal anti-Mitf antibody. For qt-PCR analysis, RNA was harvested using the RNAEasy method (Qiagen, Valencia, CA). RNA quantification and purity were assessed with UV spectrometry (optical density at 260nm/280nm). mRNA expression was quantified by quantitative Taqman pcr using QuantiTect Probe RT-PCR kits (Qiagen, Valencia, CA) and on an ICycler machine (BioRad, Hercules, CA). Mitf induction was normalized to GAPDH controls in all cases. In experiments determining direct effects of forskolin on Mitf induction, Pam212 keratinocytes or B16 melanoma cells were incubated (4h) with forskolin (80 µM), were washed with PBS twice, and then were incubated for 24h (37°C, 5% CO2). Conditioned supernatants were then collected and added to B16 cells. Negative controls consisted of vehicle-treated conditioned media and positive controls consisted of media containing 80 µM forskolin. Cells were then lysed and evaluated as described above.

Histology
Animals were either killed by CO2 narcosis or anesthetized with isoflurane anesthesia prior to skin sampling. Approximately 1 cm2 skin biopsies were obtained from sheared skin treated as described. Skin sections were immediately placed in 10% buffered formalin until paraffin embedding and sectioning (done by either the rodent histopathology core service at Harvard Medical School or the histopathology core facility at the University of Kentucky). Hematoxylin/Eosin staining and Fontana-Masson staining were performed using routine procedures and β-galactosidase staining was performed as described30.

Sunburn cell analysis and thymine dimer detection
C57BL/6 K14-SCF transgenic mc1re/e animals were treated with either vehicle control or with C. forskohlii root extract (80 µmoles forskolin) daily (5 days per week) for three weeks starting at 4 weeks of age. MC1RE/E (wild type) K14-SCF transgenic animals (used as a positive control for maximal pigmentation) and Tyrc2j/c2j (albino) K14-SCF transgenic animals (used as an amelanotic control to compare UV effects in skin containing melanocytes, but devoid of pigment) were each treated with vehicle control between the ages of four and seven weeks. At seven weeks of age, animals were shaved and irradiated with 200 mJ/cm2 UVB. After 24 hours, dorsal (exposed) skin was biopsied as described, stained with hematoxylin/eosin and examined for pyknotic nuclei in the epidermis which defines “sunburn cells”20. The number of sunburn cells in the epidermis was counted in three different animals of each treatment cohort. For thymine dimer analysis, the same pigmentation cohorts of K14-SCF transgenic animals were used, except these experiments were done in the Xeroderma pigmentosum C null (xpc-/-) genetic background. Animals were treated with either vehicle control or C. forskohlii root extract (80 µmoles forskolin) as indicated between the ages of four and seven weeks, shaved and irradiated with either 0 mJ/cm2, 20 mJ/cm2 or 50 mJ/cm2 UVB. Animals were euthanized and treated dorsal skin samples were harvested 10 minutes after UVB exposure. Samples were immediately snap-frozen in cryomedium (SAKURA, Tissue-Tek) and 8 µm sections were prepared (LEICA cryostat, CM3050) on Plus slides (Fisherbrand). Antigen retrieval was performed by heating in 5 mM Tris-1 mM EDTA buffer solution (pH 8.0) in a microwave (20 minutes boiling, then 60 minutes slow cooling to room temperature). Skin sections were incubated with a 1: 50 dilution of anti-thymine dimer monoclonal antibody (Kamiya Biomedical, Seattle, Washington) and the M.O.M. mouse IgG blocking reagent according to manufacturer’s instructions (Vector laboratories) for 1h at room temperature. For immunofluorescence, samples were incubated with 1:1000 dilution of Alexa Fluor 488-conjugated anti-mouse IgG donkey antibody (Molecular Probes, Eugene, OR) for 40 minutes at room temperature. Nuclear counterstaining was performed using a 3 minute exposure to DAPI (10 µg/ml; Molecular Probes). Secondary antibody staining controls consistently revealed little non-specific binding. For immunohistochemical analysis, endogenous peroxidase activity was blocked with DAKO Peroxidase Block (5 min, room temperature), and sections were incubated 1h at room temperature with a 1:50 dilution of anti-thymine dimer mouse monoclonal antibody (Kamiya Biomedical, Seattle, Washington). The DAKO EnVision™+ System (DakoCytomation, Carpinteria, CA) was used as directed. Secondary antibody staining controls consistently revealed little non-specific binding.

Tumor formation and chronic UV protection experiments
C57BL/6 K14-SCF transgenic mc1re/e xpc-/- animals were treated with either vehicle or with C. forskohlii root extract (80 µmoles forskolin; once daily, 5 days per week) between the ages of four and seven weeks. Topical treatments were continued throughout the next 20 weeks (along with UV exposure). Beginning at 7 weeks of age, animals were irradiated (250 mJ/cm2/day, 5 days a week) over the course of 20 weeks. During this period, all mice were shaved once a week, irradiated in the morning and treated with vehicle or forskolin in the afternoon. Animals were monitored for growth and skin pathology throughout the course of irradiation and once weekly subsequently for the next year. For growth analysis, same sex littermates of vehicle-treated or forskolin-treated animals were weighed at 16 weeks of irradiation. Skin samples were harvested from the dorsal (treated and exposed surface) or ventral (negative control) surface of animals after 16 weeks of irradiation. Biopsies were formalin-fixed, paraffin-embedded and stained with hematoxylin/eosin or Fontana-Masson as described. Thickness of skin layers was determined on a ZEISS Axioplan 2 imaging microscope and data were averaged from at least three separate animals. For tumor surveillance, animals were shaved weekly after their course of irradiation and were regularly observed for pathological changes in the skin. Lesions that were grossly identified as tumors were biopsied and examined.

Melanin quantification
Eumelanin and pheomelanin were quantitatively analyzed by HPLC based on the formation of pyrrole-2,3,5-tricarboxylic acid (PTCA) by permanganate oxidation of eumelanin and 4-amino-3-hydroxyphenylalanine (4-AHP) by hydriodic acid reductive hydrolysis of pheomelanin, respectively. These specific degradation products were determined by HPLC. Contents of eumelanin and pheomelanin contents were calculated by multiplying those of PTCA and 4-AHP by factors of 50 and 9, respectively17.

Statistical analysis
Statistical comparisons of the sunburn cell analysis and the thickness of epidermis were evaluated by students’ t-test. Cumulative tumor free survival was calculated using the Kaplan-Meier method and compared by the log rank test, and median survival was calculated by students’ t-test.
 
in the preparation of the topical solution in the rat study, it never says the amount of dried extract powder that was dissolved into the ethanol. it gives an exact amount of the solution that was applied to the rats per day but wouldn't it make a difference how many grams of powder were dissolved? or do you think they just overloaded the ethanol with the powder until it reached a maximum forskolin saturation in the ethanol?
 
Hmm i probably could get access to a centrifuge.
Would there be a way to completely purify Forskolin? I think that would work much better for a TD.

From 30g 20% i should be able to get 6g or 5(if some is lost in the process)g of pure forskolin which would be good for 1 TD.

Also since Forskolin is soluble in DMSO and ethanol, couldn't you put the 20% in a bunch of ethanol, heat it a bit, and get forskolin in the ethanol and then burn that down to a usable amount?
 
I'm really interested in this and definitely wanna try it if someone could explain me the right formula
 
somebody told me to mix 70 pct ethanol with 30 pct propyleenglycol and 80 grams of forskolin, put it in a lidded jar and shake it once or twice a day for a couple of days.
I did it yesterday and what I have now is a very dirty and thick dark liquid, you can compare it with mud.
I dont know if it will change over the next few days but who knows? Maybe another formula might be better?
 
I know the researchers having performed this study on mice have success in humans now. There's also an eyelash gel on the market containing forskolin and it darkens new lash growth which means if something increases melanin it should work on skin and hair.

I don't want to mention important names here on this forum but if you're interested in this stuff, just PM me, then I can give you some details
 
How does an interesting thread like this DIE? :confused:

You all are a bunch of shameless teases! :mad:
 
How does an interesting thread like this DIE? :confused:

You all are a bunch of shameless teases! :mad:

Hmm... I wonder if you put the forskolin in a patch if it would tan systemically or only where the patch was applied.

Yeah, I'm thinking a "Lean & Tan Patch" that you could apply once a day and get a full dose of Forskolin and maybe something else to help with complexion and fat burning. Seems like there's some potential there...
 
Nice!! ;)
 
Invalid Link Removed

Reply#36: Invalid Link Removed

"Research Companies" need to get on the ball here already ;) Invalid Link Removed
 
Back
Top