| Registered User
Join Date: Jul 2007
Stats: 5'8" 223 lbs
Posts: 142
Leave Comment Reputation: 735   | It's a word file Here it is copied.
Joe Quote:
Supplementary Information
Materials and Methods
Animals
C57BL/6JJ mice of varying pigment phenotype were crossed with K14-SCF transgenic animals also on the C57BL/6JJ background15. The pigmentation phenotypes used were C57BL/6JJ MC1RE/E Tyr+/+ (wild type, black pigmentation), C57BL/6JJ- mc1re/e (extension mutant, blonde pigmentation, abbreviated mc1re/e; Robbins, L.S., et. al., Cell, 1993, 72 (6): 827-34), and C57BL/6JJ MC1RE/E Tyrc-2J/J (albino, non-pigmented, abbreviated Tyrc-2J; Le Fur, N. et. al., Genomics, 1996, 37 (2): 245-8) animals each purchased from the Jackson Laboratory (Bar Harbor, ME). Presence of the K14-SCF transgene was assessed either by phenotype (in the case of wild type or extension animals because of obvious skin color characteristics) or by pcr amplification of DNA obtained by tail snip of a fragment specific to the K14-SCF transgene as described15 in albino animals. Xeroderma pigmentosum group C knockout mice originally generated in 129-derived embryonic stem cells but back-crossed onto the C57BL/6 background21 were purchased from Taconic (Germantown, NY). Transgenic dopachrome tautomerase-β-galactosidase mice (Mackenzie, M.A. et. al., Dev Biol, 1997, 192(1): 99-107) were obtained from Dr. Ian Jackson’s laboratory. All experiments were carried out in accordance with institutionally-approved animal protocols.
Cell Lines
The Pam212 mouse keratinocyte cell line was graciously provided by Dr. Paolo Dotto (Massachusetts General Hospital and Harvard Medical School, Boston, MA) and the Melan-C mouse melanocyte cell line was generously provided by Dr. Dorothy Bennett (St. George's Hospital Medical School, London, U.K). Pam212 cells were grown in DMEM media supplemented with 10% fetal bovine serum, penicillin, streptomycin and L-glutamine, and Melan-C cells were grown in Ham’s F10 media supplemented with 10% fetal bovine serum, penicillin, streptomycin and l-glutamine. Cells were grown to 40-60% confluence prior to use in irradiation experiments in humidified incubators supplemented with 5% CO2.
Chemicals
Unless otherwise indicated, a crude extract of Coleus forskohlii root preparation was used as a working source of forskolin (ATZ Natural, Edgewater, NJ)18. Purified forskolin was purchased from Sigma-Aldrich Chemical Corporation (St. Louis, MO). All topical agents were prepared as a weight:volume solution in a standard dermatologic vehicle of 70% ethanol, 30% propylene glycol (Sigma-Aldrich Chemical Corporation, St. Louis, MO). The C. forskohlii extract-derived topical preparation was made by mixing the dry root powder (extract) with vehicle for 1h at room temperature on a stir plate with constant agitation. Next, the solution was centrifuged (10 min, room temperature, 2,000 x g) and the soluble portion (supernatant) was collected and filtered (0.45 µ cellulose acetate filter). The C. forskohlii extract was stored at room temperature. Assay of content by the manufacturer (as well as independent analysis) confirmed that forskolin accounted for 20% (w/w) of the root extract in powder form.
Sunless tanning experiments
C57BL/6J animals between 5 and 10 weeks of age were used for these experiments unless otherwise noted. Dorsal hairs were trimmed using animal shears with a 0.25 mm head (Fisher, Pittsburgh, PA). Preparations of forskolin were applied to the sheared skin as described. Solvent (vehicle) control consisted of the same volume of ethanol/propylene glycol (without forskolin) applied to the skin of age-matched genotype-matched cohorts. Unless otherwise indicated, animals were treated once daily on their dorsal surface with 300 – 400 µl of topical agent for 5 days a week. Skin reflective colorimetry measurements were assessed with a CR-400 Colorimeter (Minolta Corporation, Japan). In all cases, the instrument was calibrated against the white standard background provided by the manufacturer before use. Degree of melanization (darkness) is described as the colorimetric measurement on the *L axis (white-black axis) of the Centre Internationale d’Eclairage (CIE) L*a*b* color system29.
UV exposure
Animals were briefly anesthetized with inhaled isoflurane, hairs were sheared with an electric animal clippers outfitted with a surgical preparatory clipper head (to cut hairs to 0.25 mm). Next, animals were exposed to ultraviolet irradiation in a custom-made Lucite chamber (Plastic Design Corporation, Massachusetts) designed to allow freedom of movement while being irradiated. UV was delivered by a double bank of UVB lamps (UV Products, Upland, CA, peak emission at 302 nm) and UV emittance was measured with the use of a UV photometer (UV Products, Upland, CA) equipped with UVB measuring head. The delivered doses were calibrated for UVB emittance. Photometric measurements revealed an additional ~25% dose of UVA emittance from the radiation source. Skin samples were biopsied at indicated time points after UV exposure. In the case of in vitro UV experiments, cells were exposed to 10 mJ/cm2 UVB radiation in a Stratalinker UV chamber (Stratagene, Cedar Creek, TX) equipped with 15W 254 nM UVB bulbs (Stratagene, Cedar Creek, TX) and calibrated using a UV photometer (UV Products, Upland, CA) equipped with UVB measuring head. For all of our experiments, we calibrated UVB dose from the lamps using a UVB-specific photometer and expressed the dose relative to the directly measured UVB exposure.
RNA extraction and Quantitative Polymerase Chain Reaction
After exposure to UVB radiation as described above, melanocyte or keratinocyte cells (as indicated) were incubated at 37şC in humidified incubators supplemented with 5% CO2. After 24 hours, media was removed and collected. This conditioned medium was used directly or depleted of MSH by serial incubation with anti-alpha-MSH (30 µg/ml, Sigma, 24h, 4°C) followed by anti-rabbit lgG (United States Biological, 10 µg/ml, 1h, room temperature) and protein A/G beads (50% (v/v), Pierce Biotechnology, 2h, room temperature). Conditioned media was added to mouse B16 melanoma cells for 6 hours. Cells were washed once with PBS, pH 7.4, and RNA was extracted using the RNAEasy method (Qiagen, Valencia, CA). RNA quantification and purity were assessed with UV spectrometry (optical density at 260nm/280nm). mRNA expression was quantified by quantitative Taqman pcr using QuantiTect Probe RT-PCR kits (Qiagen, Valencia, CA) and on an iCycler machine (BioRad, Hercules, CA). Murine POMC mRNA expression utilized the following reagents: forward primer: AGCAACCCGCCCAAGG, reverse primer: GCGTCTGGCTCTTCTCGG, probe: [6-FAM]-CAAGCGTTACGGTGGCTTCATGACC-[TAMRA-6-FAM]. Murine GAPDH mRNA expression relied on the following reagents: forward primer: GGCAAATTCAACGGCACAGT, reverse primer: AGATGGTGATGGGCTTCCC, probe: [6-FAM]-AGGCCGAGAATGGGAAGCTTGTCATC-[TAMRA-6-FAM]. Human POMC mRNA expression relied on the following reagents: Human GAPDH expression relied on the following reagents: Human Mitf reverse 5’- CGAGCTCATGGACTTTCCCTTA-3’, Human Mitf forward: CTTGATGATCCGATTCACCAAA, Human Mitf probe 6FAM-CCATCCACGGGTCTCTGCTCTCCAG-TAMRA6FAM, Mouse Mitf forward GGAGCAGAGCAGGGCAGA, Mouse Mitf reverse CATGCACGACGCTCGAGA, Mouse Mitf Probe: [6-FAM]-AGTGAGTGCCCAGGTATGAACACGCA-[TAMRA-6-FAM], Human GAPDH forward GAAGGTGAAGGTCGGAGT, Human GAPDH reverse GAAGATGGTGATGGGATTTC, Human GAPDH probe : [6-FAM]-CAAGCTTCCCGTTCTCAGCC-[TAMRA-6-FAM], Mouse GAPDH forward GTGGATCTGACGTGCCGC, Mouse GAPDH reverse TGCCTGCTTCACCACCTTC, Mouse GAPDH probe: [6-FAM] GGAGAAACCTGCCAAAGTATGATGACATCA-[TAMRA-6-FAM], Human POMC forward: CTTGCAGGCCCGGATG, Human POMC reverse: AGCAGCCAGTGTCAGGACCT, Human POMC Probe: [6-FAM]-ACCACGGAAAGCAACCTGCTGGAG-[TAMRA-6-FAM].
Mitf Quantification
Pam212 mouse keratinocytes or primary human keratinocytes were irradiated with 10 mJ/cm2 and incubated for 24h (37°C, 5% CO2). Supernatants were collected at 24h and these keratinocyte-conditioned media were used to replace the media of either B16 mouse melanoma cells or primary human melanocytes (respectively) growing in log-phase. After 6 hours, cells were harvested for protein or RNA analysis. For protein isolation, cells were lysed in Tris hydrochloride (ph 8.0) 50 mM, NaCl 150mM, EDTA 5mM, Sodium deoxycholate 0.5%. SDS-PAGE analysis and western blotting were performed by conventional techniques using the C5 monoclonal anti-Mitf antibody. For qt-PCR analysis, RNA was harvested using the RNAEasy method (Qiagen, Valencia, CA). RNA quantification and purity were assessed with UV spectrometry (optical density at 260nm/280nm). mRNA expression was quantified by quantitative Taqman pcr using QuantiTect Probe RT-PCR kits (Qiagen, Valencia, CA) and on an ICycler machine (BioRad, Hercules, CA). Mitf induction was normalized to GAPDH controls in all cases. In experiments determining direct effects of forskolin on Mitf induction, Pam212 keratinocytes or B16 melanoma cells were incubated (4h) with forskolin (80 µM), were washed with PBS twice, and then were incubated for 24h (37°C, 5% CO2). Conditioned supernatants were then collected and added to B16 cells. Negative controls consisted of vehicle-treated conditioned media and positive controls consisted of media containing 80 µM forskolin. Cells were then lysed and evaluated as described above.
Histology
Animals were either killed by CO2 narcosis or anesthetized with isoflurane anesthesia prior to skin sampling. Approximately 1 cm2 skin biopsies were obtained from sheared skin treated as described. Skin sections were immediately placed in 10% buffered formalin until paraffin embedding and sectioning (done by either the rodent histopathology core service at Harvard Medical School or the histopathology core facility at the University of Kentucky). Hematoxylin/Eosin staining and Fontana-Masson staining were performed using routine procedures and β-galactosidase staining was performed as described30.
Sunburn cell analysis and thymine dimer detection
C57BL/6 K14-SCF transgenic mc1re/e animals were treated with either vehicle control or with C. forskohlii root extract (80 µmoles forskolin) daily (5 days per week) for three weeks starting at 4 weeks of age. MC1RE/E (wild type) K14-SCF transgenic animals (used as a positive control for maximal pigmentation) and Tyrc2j/c2j (albino) K14-SCF transgenic animals (used as an amelanotic control to compare UV effects in skin containing melanocytes, but devoid of pigment) were each treated with vehicle control between the ages of four and seven weeks. At seven weeks of age, animals were shaved and irradiated with 200 mJ/cm2 UVB. After 24 hours, dorsal (exposed) skin was biopsied as described, stained with hematoxylin/eosin and examined for pyknotic nuclei in the epidermis which defines “sunburn cells”20. The number of sunburn cells in the epidermis was counted in three different animals of each treatment cohort. For thymine dimer analysis, the same pigmentation cohorts of K14-SCF transgenic animals were used, except these experiments were done in the Xeroderma pigmentosum C null (xpc-/-) genetic background. Animals were treated with either vehicle control or C. forskohlii root extract (80 µmoles forskolin) as indicated between the ages of four and seven weeks, shaved and irradiated with either 0 mJ/cm2, 20 mJ/cm2 or 50 mJ/cm2 UVB. Animals were euthanized and treated dorsal skin samples were harvested 10 minutes after UVB exposure. Samples were immediately snap-frozen in cryomedium (SAKURA, Tissue-Tek) and 8 µm sections were prepared (LEICA cryostat, CM3050) on Plus slides (Fisherbrand). Antigen retrieval was performed by heating in 5 mM Tris-1 mM EDTA buffer solution (pH 8.0) in a microwave (20 minutes boiling, then 60 minutes slow cooling to room temperature). Skin sections were incubated with a 1: 50 dilution of anti-thymine dimer monoclonal antibody (Kamiya Biomedical, Seattle, Washington) and the M.O.M. mouse IgG blocking reagent according to manufacturer’s instructions (Vector laboratories) for 1h at room temperature. For immunofluorescence, samples were incubated with 1:1000 dilution of Alexa Fluor 488-conjugated anti-mouse IgG donkey antibody (Molecular Probes, Eugene, OR) for 40 minutes at room temperature. Nuclear counterstaining was performed using a 3 minute exposure to DAPI (10 µg/ml; Molecular Probes). Secondary antibody staining controls consistently revealed little non-specific binding. For immunohistochemical analysis, endogenous peroxidase activity was blocked with DAKO Peroxidase Block (5 min, room temperature), and sections were incubated 1h at room temperature with a 1:50 dilution of anti-thymine dimer mouse monoclonal antibody (Kamiya Biomedical, Seattle, Washington). The DAKO EnVision™+ System (DakoCytomation, Carpinteria, CA) was used as directed. Secondary antibody staining controls consistently revealed little non-specific binding.
Tumor formation and chronic UV protection experiments
C57BL/6 K14-SCF transgenic mc1re/e xpc-/- animals were treated with either vehicle or with C. forskohlii root extract (80 µmoles forskolin; once daily, 5 days per week) between the ages of four and seven weeks. Topical treatments were continued throughout the next 20 weeks (along with UV exposure). Beginning at 7 weeks of age, animals were irradiated (250 mJ/cm2/day, 5 days a week) over the course of 20 weeks. During this period, all mice were shaved once a week, irradiated in the morning and treated with vehicle or forskolin in the afternoon. Animals were monitored for growth and skin pathology throughout the course of irradiation and once weekly subsequently for the next year. For growth analysis, same sex littermates of vehicle-treated or forskolin-treated animals were weighed at 16 weeks of irradiation. Skin samples were harvested from the dorsal (treated and exposed surface) or ventral (negative control) surface of animals after 16 weeks of irradiation. Biopsies were formalin-fixed, paraffin-embedded and stained with hematoxylin/eosin or Fontana-Masson as described. Thickness of skin layers was determined on a ZEISS Axioplan 2 imaging microscope and data were averaged from at least three separate animals. For tumor surveillance, animals were shaved weekly after their course of irradiation and were regularly observed for pathological changes in the skin. Lesions that were grossly identified as tumors were biopsied and examined.
Melanin quantification
Eumelanin and pheomelanin were quantitatively analyzed by HPLC based on the formation of pyrrole-2,3,5-tricarboxylic acid (PTCA) by permanganate oxidation of eumelanin and 4-amino-3-hydroxyphenylalanine (4-AHP) by hydriodic acid reductive hydrolysis of pheomelanin, respectively. These specific degradation products were determined by HPLC. Contents of eumelanin and pheomelanin contents were calculated by multiplying those of PTCA and 4-AHP by factors of 50 and 9, respectively17.
Statistical analysis
Statistical comparisons of the sunburn cell analysis and the thickness of epidermis were evaluated by students’ t-test. Cumulative tumor free survival was calculated using the Kaplan-Meier method and compared by the log rank test, and median survival was calculated by students’ t-test.
| |