Forskolin transdermal for fat burning, tanning, and acne fighting.

Page 2 of 2 First 12

  1. Thanks for the updates. Really appreciate the detail.


  2. One quick update. I've been using about 64mg forskolin ed with my 1t-4ad transdermal and I do have some noticeable tan lines before applying. I have not been in the sun tanning my back and chest at all.

    It seemed like it was working ok with acne but I did break out with 3-4 zits in my upper middle back in the area where it's really hard to reach to scrub with soap and to apply my transdermal.

    For fat loss I haven't really been dieting and I've been eating spaghetti the last couple nights so I'm feeling a little carb loaded.

    I whipped up a nice girl friendly batch and gave one to my mom. Except for the minimal ammount of isopropyl alcohol everything in it is all natural and she straight up loved it. It's actually a really good lotion it makes your hands silky smooth. I kept the dose of forskolin and green tea pretty low about 8.3mg per ml each and it's a nice light tan sort of peanut butter color. I also fragranced it with some amazing grace which I knew she likes. There's zero rub off at that dose which is good.

    I also saw something about a water soluble colforsin, I might try to find more about it, I think it would work way better.
    •   
       


  3. This could be a dumb question, but has anyone tried using the formula used in the rat study?

    Chemicals
    Unless otherwise indicated, a crude extract of Coleus forskohlii root preparation was used as a working source of forskolin (ATZ Natural, Edgewater, NJ)18. Purified forskolin was purchased from Sigma-Aldrich Chemical Corporation (St. Louis, MO). All topical agents were prepared as a weight:volume solution in a standard dermatologic vehicle of 70% ethanol, 30% propylene glycol (Sigma-Aldrich Chemical Corporation, St. Louis, MO). The C. forskohlii extract-derived topical preparation was made by mixing the dry root powder (extract) with vehicle for 1h at room temperature on a stir plate with constant agitation. Next, the solution was centrifuged (10 min, room temperature, 2,000 x g) and the soluble portion (supernatant) was collected and filtered (0.45 µ cellulose acetate filter). The C. forskohlii extract was stored at room temperature. Assay of content by the manufacturer (as well as independent analysis) confirmed that forskolin accounted for 20% (w/w) of the root extract in powder form.
    Although I doubt anyone actually has access to a centrifuge.

    Joe

  4. Where was that from? It seems like a centrifuge is how they can find out how much forskolin was in the coleus.

    No I never tried that formula ethanol dries out the skin. I was looking at 99% foskolin from a chem company and it said their research showed ethanol lowered the effectiveness of the forskolin and they reccomended 5%dmso to make the forskolin soluble.

  5. warrior I have a additive for a tanning product hit me so we can discuss.

  6. Quote Originally Posted by warriorway View Post
    Where was that from?
    This is from the actual study that was done using the transdermally applied coleus on rats.

    Joe

  7. Thanks but I have a hard time reading that second link it won't do anything in a web browser, and the file it downloaded is written in html.

  8. It's a word file Here it is copied.

    Joe

    Supplementary Information
    Materials and Methods
    Animals
    C57BL/6JJ mice of varying pigment phenotype were crossed with K14-SCF transgenic animals also on the C57BL/6JJ background15. The pigmentation phenotypes used were C57BL/6JJ MC1RE/E Tyr+/+ (wild type, black pigmentation), C57BL/6JJ- mc1re/e (extension mutant, blonde pigmentation, abbreviated mc1re/e; Robbins, L.S., et. al., Cell, 1993, 72 (6): 827-34), and C57BL/6JJ MC1RE/E Tyrc-2J/J (albino, non-pigmented, abbreviated Tyrc-2J; Le Fur, N. et. al., Genomics, 1996, 37 (2): 245-8) animals each purchased from the Jackson Laboratory (Bar Harbor, ME). Presence of the K14-SCF transgene was assessed either by phenotype (in the case of wild type or extension animals because of obvious skin color characteristics) or by pcr amplification of DNA obtained by tail snip of a fragment specific to the K14-SCF transgene as described15 in albino animals. Xeroderma pigmentosum group C knockout mice originally generated in 129-derived embryonic stem cells but back-crossed onto the C57BL/6 background21 were purchased from Taconic (Germantown, NY). Transgenic dopachrome tautomerase-β-galactosidase mice (Mackenzie, M.A. et. al., Dev Biol, 1997, 192(1): 99-107) were obtained from Dr. Ian Jackson’s laboratory. All experiments were carried out in accordance with institutionally-approved animal protocols.

    Cell Lines
    The Pam212 mouse keratinocyte cell line was graciously provided by Dr. Paolo Dotto (Massachusetts General Hospital and Harvard Medical School, Boston, MA) and the Melan-C mouse melanocyte cell line was generously provided by Dr. Dorothy Bennett (St. George's Hospital Medical School, London, U.K). Pam212 cells were grown in DMEM media supplemented with 10% fetal bovine serum, penicillin, streptomycin and L-glutamine, and Melan-C cells were grown in Ham’s F10 media supplemented with 10% fetal bovine serum, penicillin, streptomycin and l-glutamine. Cells were grown to 40-60% confluence prior to use in irradiation experiments in humidified incubators supplemented with 5% CO2.

    Chemicals
    Unless otherwise indicated, a crude extract of Coleus forskohlii root preparation was used as a working source of forskolin (ATZ Natural, Edgewater, NJ)18. Purified forskolin was purchased from Sigma-Aldrich Chemical Corporation (St. Louis, MO). All topical agents were prepared as a weight:volume solution in a standard dermatologic vehicle of 70% ethanol, 30% propylene glycol (Sigma-Aldrich Chemical Corporation, St. Louis, MO). The C. forskohlii extract-derived topical preparation was made by mixing the dry root powder (extract) with vehicle for 1h at room temperature on a stir plate with constant agitation. Next, the solution was centrifuged (10 min, room temperature, 2,000 x g) and the soluble portion (supernatant) was collected and filtered (0.45 µ cellulose acetate filter). The C. forskohlii extract was stored at room temperature. Assay of content by the manufacturer (as well as independent analysis) confirmed that forskolin accounted for 20% (w/w) of the root extract in powder form.

    Sunless tanning experiments
    C57BL/6J animals between 5 and 10 weeks of age were used for these experiments unless otherwise noted. Dorsal hairs were trimmed using animal shears with a 0.25 mm head (Fisher, Pittsburgh, PA). Preparations of forskolin were applied to the sheared skin as described. Solvent (vehicle) control consisted of the same volume of ethanol/propylene glycol (without forskolin) applied to the skin of age-matched genotype-matched cohorts. Unless otherwise indicated, animals were treated once daily on their dorsal surface with 300 – 400 µl of topical agent for 5 days a week. Skin reflective colorimetry measurements were assessed with a CR-400 Colorimeter (Minolta Corporation, Japan). In all cases, the instrument was calibrated against the white standard background provided by the manufacturer before use. Degree of melanization (darkness) is described as the colorimetric measurement on the *L axis (white-black axis) of the Centre Internationale d’Eclairage (CIE) L*a*b* color system29.

    UV exposure
    Animals were briefly anesthetized with inhaled isoflurane, hairs were sheared with an electric animal clippers outfitted with a surgical preparatory clipper head (to cut hairs to 0.25 mm). Next, animals were exposed to ultraviolet irradiation in a custom-made Lucite chamber (Plastic Design Corporation, Massachusetts) designed to allow freedom of movement while being irradiated. UV was delivered by a double bank of UVB lamps (UV Products, Upland, CA, peak emission at 302 nm) and UV emittance was measured with the use of a UV photometer (UV Products, Upland, CA) equipped with UVB measuring head. The delivered doses were calibrated for UVB emittance. Photometric measurements revealed an additional ~25% dose of UVA emittance from the radiation source. Skin samples were biopsied at indicated time points after UV exposure. In the case of in vitro UV experiments, cells were exposed to 10 mJ/cm2 UVB radiation in a Stratalinker UV chamber (Stratagene, Cedar Creek, TX) equipped with 15W 254 nM UVB bulbs (Stratagene, Cedar Creek, TX) and calibrated using a UV photometer (UV Products, Upland, CA) equipped with UVB measuring head. For all of our experiments, we calibrated UVB dose from the lamps using a UVB-specific photometer and expressed the dose relative to the directly measured UVB exposure.

    RNA extraction and Quantitative Polymerase Chain Reaction
    After exposure to UVB radiation as described above, melanocyte or keratinocyte cells (as indicated) were incubated at 37şC in humidified incubators supplemented with 5% CO2. After 24 hours, media was removed and collected. This conditioned medium was used directly or depleted of MSH by serial incubation with anti-alpha-MSH (30 µg/ml, Sigma, 24h, 4°C) followed by anti-rabbit lgG (United States Biological, 10 µg/ml, 1h, room temperature) and protein A/G beads (50% (v/v), Pierce Biotechnology, 2h, room temperature). Conditioned media was added to mouse B16 melanoma cells for 6 hours. Cells were washed once with PBS, pH 7.4, and RNA was extracted using the RNAEasy method (Qiagen, Valencia, CA). RNA quantification and purity were assessed with UV spectrometry (optical density at 260nm/280nm). mRNA expression was quantified by quantitative Taqman pcr using QuantiTect Probe RT-PCR kits (Qiagen, Valencia, CA) and on an iCycler machine (BioRad, Hercules, CA). Murine POMC mRNA expression utilized the following reagents: forward primer: AGCAACCCGCCCAAGG, reverse primer: GCGTCTGGCTCTTCTCGG, probe: [6-FAM]-CAAGCGTTACGGTGGCTTCATGACC-[TAMRA-6-FAM]. Murine GAPDH mRNA expression relied on the following reagents: forward primer: GGCAAATTCAACGGCACAGT, reverse primer: AGATGGTGATGGGCTTCCC, probe: [6-FAM]-AGGCCGAGAATGGGAAGCTTGTCATC-[TAMRA-6-FAM]. Human POMC mRNA expression relied on the following reagents: Human GAPDH expression relied on the following reagents: Human Mitf reverse 5’- CGAGCTCATGGACTTTCCCTTA-3’, Human Mitf forward: CTTGATGATCCGATTCACCAAA, Human Mitf probe 6FAM-CCATCCACGGGTCTCTGCTCTCCAG-TAMRA6FAM, Mouse Mitf forward GGAGCAGAGCAGGGCAGA, Mouse Mitf reverse CATGCACGACGCTCGAGA, Mouse Mitf Probe: [6-FAM]-AGTGAGTGCCCAGGTATGAACACGCA-[TAMRA-6-FAM], Human GAPDH forward GAAGGTGAAGGTCGGAGT, Human GAPDH reverse GAAGATGGTGATGGGATTTC, Human GAPDH probe : [6-FAM]-CAAGCTTCCCGTTCTCAGCC-[TAMRA-6-FAM], Mouse GAPDH forward GTGGATCTGACGTGCCGC, Mouse GAPDH reverse TGCCTGCTTCACCACCTTC, Mouse GAPDH probe: [6-FAM] GGAGAAACCTGCCAAAGTATGATGACATCA-[TAMRA-6-FAM], Human POMC forward: CTTGCAGGCCCGGATG, Human POMC reverse: AGCAGCCAGTGTCAGGACCT, Human POMC Probe: [6-FAM]-ACCACGGAAAGCAACCTGCTGGAG-[TAMRA-6-FAM].

    Mitf Quantification
    Pam212 mouse keratinocytes or primary human keratinocytes were irradiated with 10 mJ/cm2 and incubated for 24h (37°C, 5% CO2). Supernatants were collected at 24h and these keratinocyte-conditioned media were used to replace the media of either B16 mouse melanoma cells or primary human melanocytes (respectively) growing in log-phase. After 6 hours, cells were harvested for protein or RNA analysis. For protein isolation, cells were lysed in Tris hydrochloride (ph 8.0) 50 mM, NaCl 150mM, EDTA 5mM, Sodium deoxycholate 0.5%. SDS-PAGE analysis and western blotting were performed by conventional techniques using the C5 monoclonal anti-Mitf antibody. For qt-PCR analysis, RNA was harvested using the RNAEasy method (Qiagen, Valencia, CA). RNA quantification and purity were assessed with UV spectrometry (optical density at 260nm/280nm). mRNA expression was quantified by quantitative Taqman pcr using QuantiTect Probe RT-PCR kits (Qiagen, Valencia, CA) and on an ICycler machine (BioRad, Hercules, CA). Mitf induction was normalized to GAPDH controls in all cases. In experiments determining direct effects of forskolin on Mitf induction, Pam212 keratinocytes or B16 melanoma cells were incubated (4h) with forskolin (80 µM), were washed with PBS twice, and then were incubated for 24h (37°C, 5% CO2). Conditioned supernatants were then collected and added to B16 cells. Negative controls consisted of vehicle-treated conditioned media and positive controls consisted of media containing 80 µM forskolin. Cells were then lysed and evaluated as described above.

    Histology
    Animals were either killed by CO2 narcosis or anesthetized with isoflurane anesthesia prior to skin sampling. Approximately 1 cm2 skin biopsies were obtained from sheared skin treated as described. Skin sections were immediately placed in 10% buffered formalin until paraffin embedding and sectioning (done by either the rodent histopathology core service at Harvard Medical School or the histopathology core facility at the University of Kentucky). Hematoxylin/Eosin staining and Fontana-Masson staining were performed using routine procedures and β-galactosidase staining was performed as described30.

    Sunburn cell analysis and thymine dimer detection
    C57BL/6 K14-SCF transgenic mc1re/e animals were treated with either vehicle control or with C. forskohlii root extract (80 µmoles forskolin) daily (5 days per week) for three weeks starting at 4 weeks of age. MC1RE/E (wild type) K14-SCF transgenic animals (used as a positive control for maximal pigmentation) and Tyrc2j/c2j (albino) K14-SCF transgenic animals (used as an amelanotic control to compare UV effects in skin containing melanocytes, but devoid of pigment) were each treated with vehicle control between the ages of four and seven weeks. At seven weeks of age, animals were shaved and irradiated with 200 mJ/cm2 UVB. After 24 hours, dorsal (exposed) skin was biopsied as described, stained with hematoxylin/eosin and examined for pyknotic nuclei in the epidermis which defines “sunburn cells”20. The number of sunburn cells in the epidermis was counted in three different animals of each treatment cohort. For thymine dimer analysis, the same pigmentation cohorts of K14-SCF transgenic animals were used, except these experiments were done in the Xeroderma pigmentosum C null (xpc-/-) genetic background. Animals were treated with either vehicle control or C. forskohlii root extract (80 µmoles forskolin) as indicated between the ages of four and seven weeks, shaved and irradiated with either 0 mJ/cm2, 20 mJ/cm2 or 50 mJ/cm2 UVB. Animals were euthanized and treated dorsal skin samples were harvested 10 minutes after UVB exposure. Samples were immediately snap-frozen in cryomedium (SAKURA, Tissue-Tek) and 8 µm sections were prepared (LEICA cryostat, CM3050) on Plus slides (Fisherbrand). Antigen retrieval was performed by heating in 5 mM Tris-1 mM EDTA buffer solution (pH 8.0) in a microwave (20 minutes boiling, then 60 minutes slow cooling to room temperature). Skin sections were incubated with a 1: 50 dilution of anti-thymine dimer monoclonal antibody (Kamiya Biomedical, Seattle, Washington) and the M.O.M. mouse IgG blocking reagent according to manufacturer’s instructions (Vector laboratories) for 1h at room temperature. For immunofluorescence, samples were incubated with 1:1000 dilution of Alexa Fluor 488-conjugated anti-mouse IgG donkey antibody (Molecular Probes, Eugene, OR) for 40 minutes at room temperature. Nuclear counterstaining was performed using a 3 minute exposure to DAPI (10 µg/ml; Molecular Probes). Secondary antibody staining controls consistently revealed little non-specific binding. For immunohistochemical analysis, endogenous peroxidase activity was blocked with DAKO Peroxidase Block (5 min, room temperature), and sections were incubated 1h at room temperature with a 1:50 dilution of anti-thymine dimer mouse monoclonal antibody (Kamiya Biomedical, Seattle, Washington). The DAKO EnVision™+ System (DakoCytomation, Carpinteria, CA) was used as directed. Secondary antibody staining controls consistently revealed little non-specific binding.

    Tumor formation and chronic UV protection experiments
    C57BL/6 K14-SCF transgenic mc1re/e xpc-/- animals were treated with either vehicle or with C. forskohlii root extract (80 µmoles forskolin; once daily, 5 days per week) between the ages of four and seven weeks. Topical treatments were continued throughout the next 20 weeks (along with UV exposure). Beginning at 7 weeks of age, animals were irradiated (250 mJ/cm2/day, 5 days a week) over the course of 20 weeks. During this period, all mice were shaved once a week, irradiated in the morning and treated with vehicle or forskolin in the afternoon. Animals were monitored for growth and skin pathology throughout the course of irradiation and once weekly subsequently for the next year. For growth analysis, same sex littermates of vehicle-treated or forskolin-treated animals were weighed at 16 weeks of irradiation. Skin samples were harvested from the dorsal (treated and exposed surface) or ventral (negative control) surface of animals after 16 weeks of irradiation. Biopsies were formalin-fixed, paraffin-embedded and stained with hematoxylin/eosin or Fontana-Masson as described. Thickness of skin layers was determined on a ZEISS Axioplan 2 imaging microscope and data were averaged from at least three separate animals. For tumor surveillance, animals were shaved weekly after their course of irradiation and were regularly observed for pathological changes in the skin. Lesions that were grossly identified as tumors were biopsied and examined.

    Melanin quantification
    Eumelanin and pheomelanin were quantitatively analyzed by HPLC based on the formation of pyrrole-2,3,5-tricarboxylic acid (PTCA) by permanganate oxidation of eumelanin and 4-amino-3-hydroxyphenylalanine (4-AHP) by hydriodic acid reductive hydrolysis of pheomelanin, respectively. These specific degradation products were determined by HPLC. Contents of eumelanin and pheomelanin contents were calculated by multiplying those of PTCA and 4-AHP by factors of 50 and 9, respectively17.

    Statistical analysis
    Statistical comparisons of the sunburn cell analysis and the thickness of epidermis were evaluated by students’ t-test. Cumulative tumor free survival was calculated using the Kaplan-Meier method and compared by the log rank test, and median survival was calculated by students’ t-test.
    •   
       


  9. Have you seen any results yet from the formula?.

  10. in the preparation of the topical solution in the rat study, it never says the amount of dried extract powder that was dissolved into the ethanol. it gives an exact amount of the solution that was applied to the rats per day but wouldn't it make a difference how many grams of powder were dissolved? or do you think they just overloaded the ethanol with the powder until it reached a maximum forskolin saturation in the ethanol?

  11. Hmm i probably could get access to a centrifuge.
    Would there be a way to completely purify Forskolin? I think that would work much better for a TD.

    From 30g 20% i should be able to get 6g or 5(if some is lost in the process)g of pure forskolin which would be good for 1 TD.

    Also since Forskolin is soluble in DMSO and ethanol, couldn't you put the 20% in a bunch of ethanol, heat it a bit, and get forskolin in the ethanol and then burn that down to a usable amount?

  12. I'm really interested in this and definitely wanna try it if someone could explain me the right formula

  13. somebody told me to mix 70 pct ethanol with 30 pct propyleenglycol and 80 grams of forskolin, put it in a lidded jar and shake it once or twice a day for a couple of days.
    I did it yesterday and what I have now is a very dirty and thick dark liquid, you can compare it with mud.
    I dont know if it will change over the next few days but who knows? Maybe another formula might be better?

  14. I know the researchers having performed this study on mice have success in humans now. There's also an eyelash gel on the market containing forskolin and it darkens new lash growth which means if something increases melanin it should work on skin and hair.

    I don't want to mention important names here on this forum but if you're interested in this stuff, just PM me, then I can give you some details

  15. How does an interesting thread like this DIE?

    You all are a bunch of shameless teases!
    A-Minds HYPE-SLAYER! All posts & feedback are guaranteed to be unsolicited and legit
    "The fear of the LORD is the beginning of knowledge. Fools despise wisdom & instruction"
    Proverbs 1:7

  16. Quote Originally Posted by Whacked View Post
    How does an interesting thread like this DIE?

    You all are a bunch of shameless teases!
    Hmm... I wonder if you put the forskolin in a patch if it would tan systemically or only where the patch was applied.

    Yeah, I'm thinking a "Lean & Tan Patch" that you could apply once a day and get a full dose of Forskolin and maybe something else to help with complexion and fat burning. Seems like there's some potential there...
    NeedToBuildMuscle Representative / PowerChews Representative
    AgeForce Representative - www.ageforce.com for hGH Patches!
    Send me a PM with any questions about products & discount codes

  17. Nice!!
    A-Minds HYPE-SLAYER! All posts & feedback are guaranteed to be unsolicited and legit
    "The fear of the LORD is the beginning of knowledge. Fools despise wisdom & instruction"
    Proverbs 1:7
  18. A-Minds HYPE-SLAYER! All posts & feedback are guaranteed to be unsolicited and legit
    "The fear of the LORD is the beginning of knowledge. Fools despise wisdom & instruction"
    Proverbs 1:7

  19. Is anyone working on this forskolin patch? Or is it not worthy?

  20. It's seems to be a really good idea. It will be nice to see it working

  21. No patches yet, but if there's enough demand there should be a response.
    NeedToBuildMuscle Representative / PowerChews Representative
    AgeForce Representative - www.ageforce.com for hGH Patches!
    Send me a PM with any questions about products & discount codes

  22. IMO, I'm not convinced it's worth it to proceed.

    1) Oral Forskolin has a decent abosortion rate (well; as good as most oral products) and is cheap.
    2) A patch (just like an oral supp) will force this stuff to go systemic. See #1

    Topical application of this stuff DOES CAUSE a localized effect from what I've read thus far but it's not like you are going to put patches convering every square inch of your body LOL

    IMHO, patches would make more sense for products that have a crappy absoption rate and can be improved significantly thru use of a patch or transdermal agent (think resveratrol).
    A-Minds HYPE-SLAYER! All posts & feedback are guaranteed to be unsolicited and legit
    "The fear of the LORD is the beginning of knowledge. Fools despise wisdom & instruction"
    Proverbs 1:7

  23. Quote Originally Posted by Whacked View Post
    IMO, I'm not convinced it's worth it to proceed.

    1) Oral Forskolin has a decent abosortion rate (well; as good as most oral products) and is cheap.
    2) A patch (just like an oral supp) will force this stuff to go systemic. See #1

    Topical application of this stuff DOES CAUSE a localized effect from what I've read thus far but it's not like you are going to put patches convering every square inch of your body LOL

    IMHO, patches would make more sense for products that have a crappy absoption rate and can be improved significantly thru use of a patch or transdermal agent (think resveratrol).
    Thanks, any information on general oral absorption? I know a few ingredients, but wondering if there was some general list of oral bioavailability.
    NeedToBuildMuscle Representative / PowerChews Representative
    AgeForce Representative - www.ageforce.com for hGH Patches!
    Send me a PM with any questions about products & discount codes

  24. Beats me brother

    I wish I knew. There is simply not a ton of info out on this stuff.

    IMO - this is just one more reason to not waste your time items that have lots of unknowns ya know?

    I ordered some of that stuff used in SPRAY tans (that makes you bronze/brown and NOT orange)
    A combo of BOTH Erythrulose and DHA seem to be the most logical

    PS: This is NOT the same DHA found in Fish Oil

    I'm done with tanning beds. I'm old and can't afford any more skin damage/wrinkles.

    I also plan to take the oral version and be sure my tyrosine intake is sufficient to support the tanning process from the inside out.

    Quote Originally Posted by Milas View Post
    Thanks, any information on general oral absorption? I know a few ingredients, but wondering if there was some general list of oral bioavailability.
    A-Minds HYPE-SLAYER! All posts & feedback are guaranteed to be unsolicited and legit
    "The fear of the LORD is the beginning of knowledge. Fools despise wisdom & instruction"
    Proverbs 1:7

  25. Ever try Melanotan II?
    NeedToBuildMuscle Representative / PowerChews Representative
    AgeForce Representative - www.ageforce.com for hGH Patches!
    Send me a PM with any questions about products & discount codes

  26. Yup. Hated it. Freckling was BAD and the daily or EOD pinning was just retarded after awhile.
    A-Minds HYPE-SLAYER! All posts & feedback are guaranteed to be unsolicited and legit
    "The fear of the LORD is the beginning of knowledge. Fools despise wisdom & instruction"
    Proverbs 1:7

  27. I loved melanotan 2. I guess I got lucky. Random boners were kinda a pain. Oh and my parents found my slin needles and locked me out of the house for 3 days lol. Oh college summers home

  28. LOL!

    Quote Originally Posted by jamesm11 View Post
    Oh and my parents found my slin needles and locked me out of the house for 3 days lol. Oh college summers home
    A-Minds HYPE-SLAYER! All posts & feedback are guaranteed to be unsolicited and legit
    "The fear of the LORD is the beginning of knowledge. Fools despise wisdom & instruction"
    Proverbs 1:7
  

  
 

Similar Forum Threads

  1. Transdermal Forskolin?
    By EasyEJL in forum Supplements
    Replies: 27
    Last Post: 05-09-2011, 05:15 PM
  2. ORAL tanning supps: Canthaxanthin+Forskolin
    By Whacked in forum Supplements
    Replies: 13
    Last Post: 09-06-2010, 12:09 AM
  3. Tanning 1x a week for acne?
    By warbird01 in forum General Chat
    Replies: 4
    Last Post: 12-06-2007, 11:48 PM
  4. Tanning and acne
    By ss01 in forum Bodybuilding Contest Preperation
    Replies: 4
    Last Post: 10-10-2005, 03:43 PM
Log in
Log in